Virus:Article Title: Negative feedback control of hypothalamic feeding circuits by the taste of food.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV1.CAG.Flex.GCaMP6s.WPRE.SV40 Chen et al.80 Addgene Cat#: 100842-AAV1 AAV1.CAG.FLEX.GCaMP8s HHMI Janelia Ref ID: 1-1322-2 AAV8.hSyn.DIO.hM4D(Gi).mCherry Krashes et al.19 Addgene Cat#:44362-AAV8 AAV1.hSyn.DIO.mCherry Bryan Roth Lab Addgene Cat#:50459-AAV1 Chemicals, peptides, and recombinant proteins Devazepide R&D Systems Cat#:2304/10 Intralipid Sigma Aldrich; Medline Cat#:I141-100mL; Cat#:BHL2B6064H Silicone Oil Sigma Aldrich Cat#:378348 DAPI Fluoromount-G Southern Biotech Cat#:0100-20 Deschloroclozapine dihydrochloride Hello bio Cat#: HB9126 Clozapine-N-oxide Tocris Cat#: 4936 Experimental models: Organisms/strains B6.129-Leprtm3(cre)Mgmj/J (Common name: LepRCre) The Jackson Laboratory RRID: IMSR_JAX:032457 STOCK Agrptm1(cre)Lowl/J (Common name: Agrp-Ires-Cre) The Jackson Laboratory RRID: IMSR_JAX:012899 B6;129S-Gt(ROSA)26Sortm32(CAGCOP4*H134R/EYFP)Hze/J (Common name: Ai32(RCL-ChR2(H134R)/EYFP)) The Jackson Laboratory RRID: IMSR_JAX:012569 C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Software and algorithms GraphPad Prism 8 GraphPad Software RRID: SCR_002798 MATLAB 2017b Mathworks RRID: SCR_001622 Inscopix Data Acquisition Software Inscopix https://iqlearning.inscopix.com/ software-downloads/idas Inscopix Mosaic Software 1.2.0 Inscopix https://support.inscopix.com/support/ products/mosaic/mosaic-downloads Inscopix Data Processing Software v.1.3.1 Inscopix https://iqlearning.inscopix.com/ software-downloads/idps-archive CNMFe Zhou et al.81 https://github.com/zhoupc/CNMF_E CellReg Sheintuch et al.82 https://github.com/zivlab/CellReg R Studio version 2023.03.1 Posit RRID: SCR_000432 ImageJ (Fiji) Open source RRID: SCR_002285 Synapse Tucker-Davis Technologies https://www.tdt.com/component/ synapse-software/ Custom code Dr. Zachary Knight’s Lab Github: https://github.com/ zackknightlabucsf/zackknightlabucsf Other Rodent diet PicoLab Cat#:5053 GRIN lens Inscopix Cat#:1050-004610 Metabond Parkwell Cat#:S380 Baseplate Inscopix Cat#:100-000279 Baseplate cover Inscopix Cat#:100-000241 Mono Fiberoptic Cannula Doric Lenses Cat#:MFC_400/430-0.48 Sleeve Bronze 2.5mm Doric Lenses Cat#:SLEEVE_BR_2.5 (Continued on next page) e1 Neuron 112, 1–17.e1–e5, October 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Optical Fiber Thorlabs Cat#:FT200UMT Fiberoptic Cannula Thorlabs Cat#:CFLC230-10 Gastric catheter Instech Labs Cat#:C30PU-RGA1439 Sterile access button Instech Labs Cat#:VABM1B/22 Aluminum cap Instech Labs Cat#:VABM1C Ensure Vanilla Abbott Cat#:00750 nVista 3.0 Inscopix https://www.inscopix.com/nvista nVoke 2.0 Inscopix https://www.inscopix.com/nvoke Patch cable Doric Lenses Cat#:MFP_400/460/900- 0.48_2m_FCM-MF2.5 Four-channel LED Driver Thorlabs Cat#:DC4104 Minicube Thorlabs Cat#:FMC6_AE(400–410)_E1(450–490)_ F1(500–540)_E2(550–580)_ F2(600–680)_S Photoreceiver Newport Cat#:2151 Base Processor Tucker-Davis Technologies Cat#:RZ5P Davis Rig Med Associates Cat#:MED-DAV-160M
Article Title: GABAergic neurons in the ventral tegmental area represent and regulate force vectors.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains pAAV-EF1a-DIO-hChR2(E123T/T159C)EYFP Addgene #35509-AAV5 pAAV_hSyn1-SIO-stGtACR2-FusionRed Addgene #105677-AAV1 pAAV-Ef1a-DIO EYFP Addgene #27056-AAV5 Experimental models: Organisms/strains Mouse: VGAT-ires-cre Jackson Labs Mouse Strain: 016962 Mouse: DAT-ires-Cre: 1tm2(cre)Lowl/J Jackson Labs Mouse Strain: 006660 Mouse: Ai32: B6;129S-Gt(ROSA) 26Sortm32(CAGCOP4*H134R/EYFP)Hze/J Jackson Labs Mouse Strain: 012569 Software and algorithms MATLAB 2022b MathWorks https://www.mathworks.com/products/ matlab.html GraphPad Prism 9 GraphPad https://www.graphpad.com/scientific- software/prism/ Offline Sorter 3.0 Plexon https://plexon.com/products/offline-sorter/ NeuroExplorer 5.414 Nex Technologies http://www.neuroexplorer.com/ downloadspage/ Cerebus Central Suite Blackrock Neurotech https://blackrockneurotech.com/research/ support/software/ Other DAPI Fluoromount-G Southern Biotech Cat# 0100-20 14 Cell Reports 44, 115313, February 25, 2025 The electrodes were slowly lowered onto the VTA (AP: 3.1 to 3.4 mm,ML: ±0.3 to 0.6 mm, DV: 4.1 mm relative to bregma) and grounded to four cranial screws by a silver grounding wire. ..
Recombinant:Article Title: Negative feedback control of hypothalamic feeding circuits by the taste of food.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV1.CAG.Flex.GCaMP6s.WPRE.SV40 Chen et al.80 Addgene Cat#: 100842-AAV1 AAV1.CAG.FLEX.GCaMP8s HHMI Janelia Ref ID: 1-1322-2 AAV8.hSyn.DIO.hM4D(Gi).mCherry Krashes et al.19 Addgene Cat#:44362-AAV8 AAV1.hSyn.DIO.mCherry Bryan Roth Lab Addgene Cat#:50459-AAV1 Chemicals, peptides, and recombinant proteins Devazepide R&D Systems Cat#:2304/10 Intralipid Sigma Aldrich; Medline Cat#:I141-100mL; Cat#:BHL2B6064H Silicone Oil Sigma Aldrich Cat#:378348 DAPI Fluoromount-G Southern Biotech Cat#:0100-20 Deschloroclozapine dihydrochloride Hello bio Cat#: HB9126 Clozapine-N-oxide Tocris Cat#: 4936 Experimental models: Organisms/strains B6.129-Leprtm3(cre)Mgmj/J (Common name: LepRCre) The Jackson Laboratory RRID: IMSR_JAX:032457 STOCK Agrptm1(cre)Lowl/J (Common name: Agrp-Ires-Cre) The Jackson Laboratory RRID: IMSR_JAX:012899 B6;129S-Gt(ROSA)26Sortm32(CAGCOP4*H134R/EYFP)Hze/J (Common name: Ai32(RCL-ChR2(H134R)/EYFP)) The Jackson Laboratory RRID: IMSR_JAX:012569 C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Software and algorithms GraphPad Prism 8 GraphPad Software RRID: SCR_002798 MATLAB 2017b Mathworks RRID: SCR_001622 Inscopix Data Acquisition Software Inscopix https://iqlearning.inscopix.com/ software-downloads/idas Inscopix Mosaic Software 1.2.0 Inscopix https://support.inscopix.com/support/ products/mosaic/mosaic-downloads Inscopix Data Processing Software v.1.3.1 Inscopix https://iqlearning.inscopix.com/ software-downloads/idps-archive CNMFe Zhou et al.81 https://github.com/zhoupc/CNMF_E CellReg Sheintuch et al.82 https://github.com/zivlab/CellReg R Studio version 2023.03.1 Posit RRID: SCR_000432 ImageJ (Fiji) Open source RRID: SCR_002285 Synapse Tucker-Davis Technologies https://www.tdt.com/component/ synapse-software/ Custom code Dr. Zachary Knight’s Lab Github: https://github.com/ zackknightlabucsf/zackknightlabucsf Other Rodent diet PicoLab Cat#:5053 GRIN lens Inscopix Cat#:1050-004610 Metabond Parkwell Cat#:S380 Baseplate Inscopix Cat#:100-000279 Baseplate cover Inscopix Cat#:100-000241 Mono Fiberoptic Cannula Doric Lenses Cat#:MFC_400/430-0.48 Sleeve Bronze 2.5mm Doric Lenses Cat#:SLEEVE_BR_2.5 (Continued on next page) e1 Neuron 112, 1–17.e1–e5, October 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Optical Fiber Thorlabs Cat#:FT200UMT Fiberoptic Cannula Thorlabs Cat#:CFLC230-10 Gastric catheter Instech Labs Cat#:C30PU-RGA1439 Sterile access button Instech Labs Cat#:VABM1B/22 Aluminum cap Instech Labs Cat#:VABM1C Ensure Vanilla Abbott Cat#:00750 nVista 3.0 Inscopix https://www.inscopix.com/nvista nVoke 2.0 Inscopix https://www.inscopix.com/nvoke Patch cable Doric Lenses Cat#:MFP_400/460/900- 0.48_2m_FCM-MF2.5 Four-channel LED Driver Thorlabs Cat#:DC4104 Minicube Thorlabs Cat#:FMC6_AE(400–410)_E1(450–490)_ F1(500–540)_E2(550–580)_ F2(600–680)_S Photoreceiver Newport Cat#:2151 Base Processor Tucker-Davis Technologies Cat#:RZ5P Davis Rig Med Associates Cat#:MED-DAV-160M
Article Title: Protocol for stimulating specific rodent limb receptive fields while recording in vivo somatosensory-evoked activity.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, peptides, and recombinant proteins Acetic acid, 99.7%, ACS reagent Sigma-Aldrich Cat# 00761AJ Agar Sigma-Aldrich Cat# A7002-250G Chicago Sky Blue 6B Sigma-Aldrich Cat# 8679 DAPI Fluoromount-G Southern Biotech Cat# 0100-20 DPX mountant for histology Sigma-Aldrich Cat#06522-100ML Ethanol Panreac Quı́mica S.L.U. .. Cat# 131086.1214 Fluoromount-G Southern Biotech Cat# 0100-01 Formalin (4% formaldehyde) Sigma-Aldrich Cat# 1.00496 Gelatin powder Merck Cat# 1.04078.1000 Heparin Laboratorio Reig Jofré, S.A. Cat# 608737.4 Hoechst 33342 dye Sigma-Aldrich Cat# B2261 Isoflurane (AErrane) Baxter Cat# FDG9623 Lidocaine 2% Normon Cat# P06B1 Methanol Sigma-Aldrich Cat# 34860-1L-R Pentobarbital sodium (Dolethal) Vetoquinol Group N/A (Continued on next page) 6 STAR Protocols 5, 102972, June 21, 2024 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Phosphate buffer solution 0.1 M (PB) Sigma-Aldrich Cat# P5244 Phosphate-buffered saline (PBS) Sigma-Aldrich Cat# P7059 Povidone iodine 10% Laboratorio Reig Jofré, S.A. Cat# 838151.7 Saline solution 0.9% B. Braun Medical, S.A. Cat# 607189.2 Sucrose Sigma-Aldrich Cat# S9378 Thionine acetate salt Sigma-Aldrich Cat# T7029-5G Tissue freezing medium Leica Biosystems Cat#14020108926 Xylene Sigma-Aldrich Cat# 534056 Experimental models: Organisms/strains C57BL6/J male or female mice (8–16 weeks) Jackson Laboratory JAX:000664, RRID:IMSR_JAX:000664 Software and algorithms Igor Pro, Wavemetrics WaveMetrics RRID:SCR_000325 https://www.wavemetrics.com ImageJ Schneider et al.6 RRID:SCR_003070 https://imagej.nih.gov/ij/ MATLAB The MathWorks, Inc. RRID:SCR_001622 https://jp.mathworks.com/ OmniPlex Server and PlexControl software Plexon Inc RRID:SCR_014803 SARFIA (Igor Pro, Wavemetrics) Dorostkar et al.7 https://www.wavemetrics. com/project/SARFIA Spike2 v7 Cambridge Electronic Design (CED) RRID:SCR_000903 Deposited data Custom-written scripts for processing data in Spike2 This study https://doi.org/10.5281/ zenodo.10365406 Other 8-channel digital headstages Omnetics Connector Corporation HST/8o25-9P-GR Adapter for recording probe (32–16 channels) NeuroNexus Technologies Inc. Adpt-A16-A32 Alloy thread of tin (60%) and lead (40%) Multicore Cat# 295-4836 Anesthesia system Medical Supplies & Services, Int.
Article Title: Separation-of-function mutants reveal the NF-κB-independent involvement of IκBα in the regulation of intestinal stemness.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488 donkey anti-rabbit (2ary) Invitrogen Cat#A21206; RRID: AB_141708 Alexa Fluor 488 donkey anti-mouse (2ary) Invitrogen Cat#A21202; RRID: AB_141607 Alexa Fluor 546 donkey anti-rabbit (2ary) Invitrogen Cat#A10040; RRID: AB_2534016 Alexa Fluor 546 donkey anti-mouse (2ary) Invitrogen Cat#A11036; RRID: AB_10563566 anti-IkBa Santa Cruz Biotechnology Cat#sc-371; RRID: AB_2235952 anti-p50 Santa Cruz Biotechnology Cat#sc-7178; RRID: AB_650211 anti-p65 Santa Cruz Biotechnology Cat#sc-109; RRID: AB_632039 anti-Lamin B Cell Signaling Cat#12586; RRID:AB_2650517 anti-HA Babco Cat#MMS-101R; RRID: AB_291262 anti-SUZ12 Abcam Cat#ab12073; RRID: AB_442939 anti-Tubulin (clone B-5-1-2) Sigma-Aldrich Cat#T6074; RRID: AB_477582 anti-MUC5AC (clone 45M1) Invitrogen Cat#MA5-12178; RRID: AB_10978001 anti-Ki67 (clone MM1) NovoCastra Cat#NCL-Ki67-MM1; RRID: AB_442101 anti-FLAG M2 Sigma-Aldrich Cat#F1804; RRID: AB_262044 Alexa Fluor 647 donkey anti-mouse (2ary) Invitrogen Cat#A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit (2ary) Invitrogen Cat#A31573; RRID: AB_2536183 Biological samples Intestinal mouse organoids HMRIB HMRIB Chemicals, peptides, and recombinant proteins DMEM Sigma-Aldrich Cat#D6429 Advanced DMEM/F12 Thermo Fisher Scientific (Gibco) Cat#12634010 B27 supplement (50x) Thermo Fisher Scientific (Gibco) Cat#08–0085 SA N2 supplement (100x) Thermo Fisher Scientific (Gibco) Cat#17502-001 L-Glutamine 100X Thermo Fisher Scientific (Gibco) Cat#25030081 Penicillin/Streptomycin (10.000 U/ml) Thermo Fisher Scientific (Gibco) Cat#15140122 Epidermal Growth Factor, human Sigma-Aldrich Cat#E9644 Recombinant murine Noggin Peprotech Cat#250-38 Mouse R-Spondin 1 Recombinant Protein Peprotech Cat#315-32 Corning® Matrigel® Basement Membrane Matrix Corning Cat#45356234 ROCK inhibitor (Y-27632) Sigma-Aldrich Cat#Y0503 Mouse FGF-basic (FGF-2/bFGF) Recombinant Protein Thermo Fisher Scientific Cat#450-33 Complete Mini protease inhibitor cocktail Roche Cat#11-836-170-001 DPX mountant Sigma-Aldrich Cat#06522 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Protein A-Sepharose CL-4B GE Healthcare Cat17-0780-01 Protein G-Sepharose 4 Fast Flow GE Healthcare Cat#17-0618-01 Alcian blue solution Merck-Milipore Cat#101647 Nuclear Fast Red solution Sigma-Aldrich Cat#6409-77-4 Polyethylenimine Polysciences Inc. Cat#23996 Formaldehyde Sigma-Aldrich Cat#252549 Glycine Sigma-Aldrich Cat#G8790 Dynabeads A Invitrogen Cat#10002D (Continued on next page) 16 Cell Reports 44, 115949, July 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dynabeads G Invitrogen Cat#10003D Critical commercial assays Envision+ System HRP Labeled Polymer anti-Mouse DAKO Cat#K4001 3,30-diaminobenzidine (DAB) DAKO Cat#K3468 EZ-ECL Chemiluminescence Detection Kit for HRP Biological Industries Cat#20-500-120 ECL Prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 RNeasy Micro Kit Qiagen Cat#74004 Transcriptor First Strand cDNA Synthesis Kit Roche Cat#04896866001 SYBR Green I Master Kit Roche Cat#04887352001 Lenti-X Concentrator Clontech Cat#631232 QIAquick PCR Purification Kit Qiagen Cat #28106 Deposited data RNA-seq inducible IkBa SOF mutants This paper SuperSeries GSE239796 (SubSeries GSE206515) ChIP-seq IkBa-FLAG (HT29 and HCT116 cell lines) This paper SuperSeries GSE239796 (SubSeries GSE271349) RNA-seq KI IkBa SOF mutants This paper SuperSeries GSE239796 (SubSeries GSE292288) Western blot original data This paper Mendeley Data at https://data.mendeley. com/datasets/fm49hhpdg3/1 (https://doi. org/10.17632/fm49hhpdg3.1) Experimental models: Cell lines HCT 116 ATCC Cat#CCL-247 HT-29 M6 derived from HT-29 ATCC Cat#HTB-38D HEK293T ATCC Cat#CRL-11268 Experimental models: Organisms/strains IκBa knockout (KO) (B6; 129S4Nfkbiatm1Bal/J) mice The Jackson Laboratory Cat#002850 (RRID:IMSR_JAX:002850) Oligonucleotides Primers for inducible mutants, see Table S7 This paper N/A Primers for knockin constructs, see Table S7 This paper N/A Primers for RT-qPCR, see Table S8 This paper N/A Recombinant DNA Plasmid: pMD2.G pMD2.G was a gift from Didier Trono Addgene plasmid Cat#12259; http://n2t. net/addgene:12259; RRID:Addgene_12259 Plasmid: pCMV-dR8.2 dvpr pCMV-dR8.2 dvpr was a gift from Bob Weinberg; Stewart et al., 2003 Addgene plasmid # 8455; http://n2t.net/ addgene:8455; RRID:Addgene_8455 Software and algorithms Prism 10 (v10.3.1.)
Article Title: Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH (6C5) (dilution 1:1000) Santa Cruz Cat#sc-32233 Rabbit polyclonal anti-TMEM173/ STING (dilution 1:1000) ProteinTech Cat#19851-1-AP; RRID: AB_10665370 Goat anti-mouse IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2003 Goat anti-rabbit IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2001 (TRITC)-conjugated affinipure goat anti-rabbit IgG (dilution 1:100) ProteinTech Cat#SA00003-2; RRID: AB_2890897 Chemicals, peptides, and recombinant proteins Bovine serum albumin (BSA) Genview Cat#FA016 Paraformaldehyde Sangon Biotech Cat#A500684 RIPA lysis buffer Solarbio Cat#R0020 PBS Solarbio Cat#P1020 Puromycin Sangon Biotech Cat#A610593 Polyethylenimine, linear, MW 25000, transfection grade Polysciences Cat#23966-100 ECL Western Blotting Substrate Millipore Cat#WBKLS0500 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Fetal bovine serum ExCell Bio Cat#FND500 Dulbecco’s modified Eagle’s medium (DMEM) Corning 10-013-CV Roswell Park Memorial Institute (RPMI)-1640 medium Corning 10-040-CV 0.05% (w/v) trypsin HyClone SH30236.02 SDS Sangon Biotech Cat#A600485 KCl Sangon Biotech Cat#A610440 KH2PO4 Sangon Biotech Cat#A600445 NaCl Sangon Biotech Cat#A501218 EDTA Sangon Biotech Cat#B548402 TWEEN 20 Sigma-Aldrich Cat#P2287 Triton X-100 Sigma-Aldrich Cat#T8787 Agarose Biosharp Life Sciences Cat#BS081 Na2HPO4$12H2O Sangon Biotech Cat#A607793 Critical commercial assays ViraTrap Lentivirus Concentration Reagent Biomiga Cat#BW-V2001-03 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Oligonucleotides Sg-STING-A This paper GCGGGCCGACCGCATTTGGG Sg-STING-B This paper ATCCATCCATCCCGTGTCCC Recombinant DNA pBS-CMV-gagpol Addgene Cat#35614 psPAX2 Addgene Cat#12260 pCMV-VSV-G Addgene Cat#8454 lentiCRISPR V2 Addgene Cat#52961 Software and algorithms FiJi (v2.0.0-rc-69/1.52i) ImageJ Schindelin et al.6 https://imagej.net/software/fiji/ Prism 9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Photoshop Adobe https://www.adobe.com/ cn/products/photoshop.html Adobe Illustrator Adobe https://www.adobe.com/ cn/products/illustrator.html (Continued on next page) 2 STAR Protocols 4, 102032, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other 6 well cell culture plate Nest Cat#703001 12 well cell culture plate Nest Cat#712001 15 mL centrifuge tube Nest Cat#601052 50 mL centrifuge tube Nest Cat#602052 Confocal laser scanning microscope Leica TCS SP5 Microscope slide Sail Brand Cat#7107 Circle microscope cover glass Nest Cat#801007 Centrifuge Eppendorf 5810/5810R Tannon-5500 gel imager Tannon Cat#5500 ll OPEN ACCESSProtocol
Article Title: LIMK1 Variants Are Associated with Divergent Endocrinological Phenotypes and Altered Exocytosis Dynamics
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Phosphorylated-Cofilin Cell Signaling Cat#: CST 3313T Cofilin Cell Signaling Cat#: CST 5175S LIMK1 Enzo life sciences Cat#: ALX-803-343-C100 GAPDH Novus Biologicals Cat#: NB300-221, RRID: AB_1007762 Mouse Anti-a-Tubulin Millipore Cat#: T5168, RRID: AB_477579 Live/dead fixable viability dye Thermofisher Cat#: 65-0866-18 CD3 Biolegend Cat#: 100216, RRID: AB_493697 CD19 Sony Biotechnology Cat#: 2111140 DRAQ5 Biolegend Cat#: 424101 Phalloidin Sigma Aldrich Cat#: P1951, RRID: AB_2315148 Goat anti rabbit Dako Cat#: P044801-2 Rabbit anti mouse Dako Cat#: P0260, RRID: AB_2636929 Rat anti-HA Roche Cat#: 11867423001, RRID: AB_390918 Phalloidin-iFluor 488 Reagent Abcam Cat#: ab176753 Biological samples Patient derived fibroblasts (individual 1 and 2) and healthy control fibroblasts Wilhelmina Children’s Hospital N/A Patient derived PBMCs and healthy donor PBMCs Wilhelmina Children’s Hospital N/A Patient with LIMK1/ELN hemideletion Center Hospitalier Universitaire (CHU) Dijon N/A Chemicals, peptides, and recombinant proteins FBS Sigma Cat #F7524 DAPI Fluoromount-G Southern Biotech Cat#: 0100-20 Radioimmunoprecipitation assay (RIPA) buffer Sigma Aldrich Cat#: R0278-50mL Polyvinylidene fluoride (PVDF) membranes Millipore Sigma Cat#: IPFL00010 DMEM/F-12 Thermofisher Cat#:11765054 HAM’s F-12 Nutrient Mix Thermofisher Cat#: 11765054 RPMI GenClone Cat#: 25-506 Sodium Pyruvate HyClone Cat#: SH30239.01 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences Cat#: 554714 StemPro Accutase Cell Dissociation Reagent Thermofisher Cat#: A1110501 HEPES GoldBio Cat#: H-400-1 FBS (for INS-1 cells) GenClone Cat#: 52-525 Penicillin-Streptomycin Thermofisher Cat#: 15140122 Trypsin Thermofisher Cat#: 15400054 TrypLE Thermofisher Cat#: 12604021 Phosphatase inhibitor cocktail Merck Cat#: P5726-1ML Ficoll Paque Sigma Cat#: GE17-1440-02 Protease inhibitor cocktail Fisher Scientific Cat#: 10516495 Puromycin GoldBio Cat#: P-600-100 PEI Sigma Cat#: 03880 Gibson Assembly Master Mix New England Biolabs Cat#: E2611L Lipofectamine 2000 ThermoFisher Cat#: 11668027 Glass Coverslips Warner Instruments Cat#: 64-0735 (Continued on next page) iScience 28, 112585, June 20, 2025 e1 ..
Software:Article Title: Negative feedback control of hypothalamic feeding circuits by the taste of food.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV1.CAG.Flex.GCaMP6s.WPRE.SV40 Chen et al.80 Addgene Cat#: 100842-AAV1 AAV1.CAG.FLEX.GCaMP8s HHMI Janelia Ref ID: 1-1322-2 AAV8.hSyn.DIO.hM4D(Gi).mCherry Krashes et al.19 Addgene Cat#:44362-AAV8 AAV1.hSyn.DIO.mCherry Bryan Roth Lab Addgene Cat#:50459-AAV1 Chemicals, peptides, and recombinant proteins Devazepide R&D Systems Cat#:2304/10 Intralipid Sigma Aldrich; Medline Cat#:I141-100mL; Cat#:BHL2B6064H Silicone Oil Sigma Aldrich Cat#:378348 DAPI Fluoromount-G Southern Biotech Cat#:0100-20 Deschloroclozapine dihydrochloride Hello bio Cat#: HB9126 Clozapine-N-oxide Tocris Cat#: 4936 Experimental models: Organisms/strains B6.129-Leprtm3(cre)Mgmj/J (Common name: LepRCre) The Jackson Laboratory RRID: IMSR_JAX:032457 STOCK Agrptm1(cre)Lowl/J (Common name: Agrp-Ires-Cre) The Jackson Laboratory RRID: IMSR_JAX:012899 B6;129S-Gt(ROSA)26Sortm32(CAGCOP4*H134R/EYFP)Hze/J (Common name: Ai32(RCL-ChR2(H134R)/EYFP)) The Jackson Laboratory RRID: IMSR_JAX:012569 C57BL/6J The Jackson Laboratory RRID: IMSR_JAX:000664 Software and algorithms GraphPad Prism 8 GraphPad Software RRID: SCR_002798 MATLAB 2017b Mathworks RRID: SCR_001622 Inscopix Data Acquisition Software Inscopix https://iqlearning.inscopix.com/ software-downloads/idas Inscopix Mosaic Software 1.2.0 Inscopix https://support.inscopix.com/support/ products/mosaic/mosaic-downloads Inscopix Data Processing Software v.1.3.1 Inscopix https://iqlearning.inscopix.com/ software-downloads/idps-archive CNMFe Zhou et al.81 https://github.com/zhoupc/CNMF_E CellReg Sheintuch et al.82 https://github.com/zivlab/CellReg R Studio version 2023.03.1 Posit RRID: SCR_000432 ImageJ (Fiji) Open source RRID: SCR_002285 Synapse Tucker-Davis Technologies https://www.tdt.com/component/ synapse-software/ Custom code Dr. Zachary Knight’s Lab Github: https://github.com/ zackknightlabucsf/zackknightlabucsf Other Rodent diet PicoLab Cat#:5053 GRIN lens Inscopix Cat#:1050-004610 Metabond Parkwell Cat#:S380 Baseplate Inscopix Cat#:100-000279 Baseplate cover Inscopix Cat#:100-000241 Mono Fiberoptic Cannula Doric Lenses Cat#:MFC_400/430-0.48 Sleeve Bronze 2.5mm Doric Lenses Cat#:SLEEVE_BR_2.5 (Continued on next page) e1 Neuron 112, 1–17.e1–e5, October 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Optical Fiber Thorlabs Cat#:FT200UMT Fiberoptic Cannula Thorlabs Cat#:CFLC230-10 Gastric catheter Instech Labs Cat#:C30PU-RGA1439 Sterile access button Instech Labs Cat#:VABM1B/22 Aluminum cap Instech Labs Cat#:VABM1C Ensure Vanilla Abbott Cat#:00750 nVista 3.0 Inscopix https://www.inscopix.com/nvista nVoke 2.0 Inscopix https://www.inscopix.com/nvoke Patch cable Doric Lenses Cat#:MFP_400/460/900- 0.48_2m_FCM-MF2.5 Four-channel LED Driver Thorlabs Cat#:DC4104 Minicube Thorlabs Cat#:FMC6_AE(400–410)_E1(450–490)_ F1(500–540)_E2(550–580)_ F2(600–680)_S Photoreceiver Newport Cat#:2151 Base Processor Tucker-Davis Technologies Cat#:RZ5P Davis Rig Med Associates Cat#:MED-DAV-160M
Article Title: Hypoxia activates SREBP2 through Golgi disassembly in bone marrow-derived monocytes for enhanced tumor growth.
Article Snippet: Fibroblast Basal Medium Lonza Cat# CC-3131 DMEM (High Glucose) Nacalai Tesque Cat# 08459-64 RPMI Medium 1640 Nacalai Tesque Cat# 30264-56 Fetal Bovine Serum Biosera Cat# FB-1285/25 Newborn Calf Lipoprotein-deficient Serum Sigma-Aldrich Cat# S5394 Sulforhodamine B sodium salt Sigma-Aldrich Cat# S1402-5G Ribonuclease Nippon Gene Cat# 313-01461 Propidium Iodide FUJIFILM Wako Cat# 25535-16-4 Mevastatin Sigma-Aldrich Cat# 474700 Mevalonolactone Sigma-Aldrich Cat# M4667 Cholesterol Sigma-Aldrich Cat# C8667 25-hydroxycholesterol Sigma-Aldrich Cat# H1015 Calpain Inhibitor I Nacalai Tesque Cat# 07036-24 DMSO Nacalai Tesque Cat# 09659-14 Methanol FUJIFILM Wako Cat# 134-11821 Ethanol FUJIFILM Wako Cat# 057-00456 14 of 22 The EMBO Journal 42: e114032 | 2023 2023 The Authors D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2001:448a:2022:c5c6:f4a2:de9a:e385:e54e. .. Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number Mepanipyrim FUJIFILM Wako Cat# 137-12651 Nocodazole FUJIFILM Wako Cat# 140-08531 Brefeldin A LKT Laboratories Cat# B6816 Phorbol 12-myristate 13-acetate (PMA) AdipoGen Cat# AG-CN2-0010-M010 Pimonidazole Hydrochloride Shinsuke Sando (The University of Tokyo) N/A Atorvastatin calcium salt trihydrate Tokyo Chemical Industry Cat# A2476 Bindarit Cayman Cat# 11479 Isogen reagent Nippon Gene Cat# 311-02504 5X PrimeScript RT Master Mix Takara Cat# RR036A Lipofectamine® RNAiMAX Reagent Thermo Fisher Scientific Cat# 13778-100 Opti-MEM Reduced Serum Medium Thermo Fisher Scientific Cat# 31985-070 DAPI-Fluoromount-G Southern Biotech Cat# 0100-20 cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich Cat# 11836170001 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 SuperSignalTM West Dura Extended Duration Substrate Thermo Fisher Scientific Cat# 34075 Ponceau S Nacalai Tesque Cat# 28322-72 Formaldehyde solution Wako Cat# 064-00406 4% paraformaldehyde phosphatebuffered solution FUJIFILM Wako Cat# 163-20145 Software Include version where applicable IMPaLa Kamburov et al (2011) http://impala.molgen.mpg.de/ GeneChip Operating Software Thermo Fisher Scientific https://www.thermofisher.com/jp/en/home/ life-science/microarray-analysis/ LAS X (v. 4.2.1) Leica https://www.leica-microsystems.com/ Seurat 4.0.1 Butler et al (2018) https://satijalab.org/seurat/ Scanpy 1.7.2 Wolf et al (2018) https://scanpy.readthedocs.io/en/stable/ GSVA package 1.38.2 H€anzelmann et al (2013) https://www.bioconductor.org/packages/ release/bioc/html/GSVA.html fgsea package 1.16.0 Korotkevich et al (preprint: Korotkevich et al, 2016) http://bioconductor.org/packages/release/ bioc/html/fgsea.html glmnet package 4.0.2 Hurvich & Tsai (1995) https://cran.r-project.org/web/packages/ glmnet/index.html GEPIA2 Tang et al (2019) http://gepia2.cancer-pku.cn Kaplan-Meier Plotter L anczky et al (2016) http://kmplot.com/analysis/ Other Kits, instrumentation, laboratory equipment, lab ware etc. that are critical for the experimental procedure and do not fit in any of the above categories can be listed here. .. RNeasy microKit Qiagen Cat# 74134 TruSeq RNA Library Prep Illumina Cat# RS-122-2001 or RS-122-2002 Genechip Human Genome U133 plus 2.0 oligonucleotide arrays Thermo Fisher Scientific Cat# 900466 THUNDERBIRD® Probe qPCR Mix TOYOBO Cat# QPS-101 Total Cholesterol Assay Kit (Fluorometric) Cell Biolabs Cat# STA-390 QIA quick PCR purification kit QIAGEN Cat# 28181 2023 The Authors The EMBO Journal 42: e114032 | 2023 15 of 22 D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2001:448a:2022:c5c6:f4a2:de9a:e385:e54e.
Article Title: GABAergic neurons in the ventral tegmental area represent and regulate force vectors.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains pAAV-EF1a-DIO-hChR2(E123T/T159C)EYFP Addgene #35509-AAV5 pAAV_hSyn1-SIO-stGtACR2-FusionRed Addgene #105677-AAV1 pAAV-Ef1a-DIO EYFP Addgene #27056-AAV5 Experimental models: Organisms/strains Mouse: VGAT-ires-cre Jackson Labs Mouse Strain: 016962 Mouse: DAT-ires-Cre: 1tm2(cre)Lowl/J Jackson Labs Mouse Strain: 006660 Mouse: Ai32: B6;129S-Gt(ROSA) 26Sortm32(CAGCOP4*H134R/EYFP)Hze/J Jackson Labs Mouse Strain: 012569 Software and algorithms MATLAB 2022b MathWorks https://www.mathworks.com/products/ matlab.html GraphPad Prism 9 GraphPad https://www.graphpad.com/scientific- software/prism/ Offline Sorter 3.0 Plexon https://plexon.com/products/offline-sorter/ NeuroExplorer 5.414 Nex Technologies http://www.neuroexplorer.com/ downloadspage/ Cerebus Central Suite Blackrock Neurotech https://blackrockneurotech.com/research/ support/software/ Other DAPI Fluoromount-G Southern Biotech Cat# 0100-20 14 Cell Reports 44, 115313, February 25, 2025 The electrodes were slowly lowered onto the VTA (AP: 3.1 to 3.4 mm,ML: ±0.3 to 0.6 mm, DV: 4.1 mm relative to bregma) and grounded to four cranial screws by a silver grounding wire. ..
other:Article Title: Divergent sensory pathways of sneezing and coughing.
Article Snippet: C57BL/6Jwild-type (Stock#: 000664),B6N.129S1-Mrgprb4tm3(cre)And/J (Stock#: 021077),B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/ J (ROSA26tdTomato; Stock#: 007905), B6N.Cg-Ssttm2.1(cre)Zjh/J (Stock#: 018973), B6N;129-Tg(CAG-CHRM3*,-mCitrine)1Ute/J (Stock#: 026220), B6;129-Gt(ROSA)26Sortm2Nat/J (ROSA26IAP, Stock#: 009253) mice were ordered from the Jackson Laboratory.
Membrane:Article Title: Separation-of-function mutants reveal the NF-κB-independent involvement of IκBα in the regulation of intestinal stemness.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488 donkey anti-rabbit (2ary) Invitrogen Cat#A21206; RRID: AB_141708 Alexa Fluor 488 donkey anti-mouse (2ary) Invitrogen Cat#A21202; RRID: AB_141607 Alexa Fluor 546 donkey anti-rabbit (2ary) Invitrogen Cat#A10040; RRID: AB_2534016 Alexa Fluor 546 donkey anti-mouse (2ary) Invitrogen Cat#A11036; RRID: AB_10563566 anti-IkBa Santa Cruz Biotechnology Cat#sc-371; RRID: AB_2235952 anti-p50 Santa Cruz Biotechnology Cat#sc-7178; RRID: AB_650211 anti-p65 Santa Cruz Biotechnology Cat#sc-109; RRID: AB_632039 anti-Lamin B Cell Signaling Cat#12586; RRID:AB_2650517 anti-HA Babco Cat#MMS-101R; RRID: AB_291262 anti-SUZ12 Abcam Cat#ab12073; RRID: AB_442939 anti-Tubulin (clone B-5-1-2) Sigma-Aldrich Cat#T6074; RRID: AB_477582 anti-MUC5AC (clone 45M1) Invitrogen Cat#MA5-12178; RRID: AB_10978001 anti-Ki67 (clone MM1) NovoCastra Cat#NCL-Ki67-MM1; RRID: AB_442101 anti-FLAG M2 Sigma-Aldrich Cat#F1804; RRID: AB_262044 Alexa Fluor 647 donkey anti-mouse (2ary) Invitrogen Cat#A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit (2ary) Invitrogen Cat#A31573; RRID: AB_2536183 Biological samples Intestinal mouse organoids HMRIB HMRIB Chemicals, peptides, and recombinant proteins DMEM Sigma-Aldrich Cat#D6429 Advanced DMEM/F12 Thermo Fisher Scientific (Gibco) Cat#12634010 B27 supplement (50x) Thermo Fisher Scientific (Gibco) Cat#08–0085 SA N2 supplement (100x) Thermo Fisher Scientific (Gibco) Cat#17502-001 L-Glutamine 100X Thermo Fisher Scientific (Gibco) Cat#25030081 Penicillin/Streptomycin (10.000 U/ml) Thermo Fisher Scientific (Gibco) Cat#15140122 Epidermal Growth Factor, human Sigma-Aldrich Cat#E9644 Recombinant murine Noggin Peprotech Cat#250-38 Mouse R-Spondin 1 Recombinant Protein Peprotech Cat#315-32 Corning® Matrigel® Basement Membrane Matrix Corning Cat#45356234 ROCK inhibitor (Y-27632) Sigma-Aldrich Cat#Y0503 Mouse FGF-basic (FGF-2/bFGF) Recombinant Protein Thermo Fisher Scientific Cat#450-33 Complete Mini protease inhibitor cocktail Roche Cat#11-836-170-001 DPX mountant Sigma-Aldrich Cat#06522 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Protein A-Sepharose CL-4B GE Healthcare Cat17-0780-01 Protein G-Sepharose 4 Fast Flow GE Healthcare Cat#17-0618-01 Alcian blue solution Merck-Milipore Cat#101647 Nuclear Fast Red solution Sigma-Aldrich Cat#6409-77-4 Polyethylenimine Polysciences Inc. Cat#23996 Formaldehyde Sigma-Aldrich Cat#252549 Glycine Sigma-Aldrich Cat#G8790 Dynabeads A Invitrogen Cat#10002D (Continued on next page) 16 Cell Reports 44, 115949, July 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dynabeads G Invitrogen Cat#10003D Critical commercial assays Envision+ System HRP Labeled Polymer anti-Mouse DAKO Cat#K4001 3,30-diaminobenzidine (DAB) DAKO Cat#K3468 EZ-ECL Chemiluminescence Detection Kit for HRP Biological Industries Cat#20-500-120 ECL Prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 RNeasy Micro Kit Qiagen Cat#74004 Transcriptor First Strand cDNA Synthesis Kit Roche Cat#04896866001 SYBR Green I Master Kit Roche Cat#04887352001 Lenti-X Concentrator Clontech Cat#631232 QIAquick PCR Purification Kit Qiagen Cat #28106 Deposited data RNA-seq inducible IkBa SOF mutants This paper SuperSeries GSE239796 (SubSeries GSE206515) ChIP-seq IkBa-FLAG (HT29 and HCT116 cell lines) This paper SuperSeries GSE239796 (SubSeries GSE271349) RNA-seq KI IkBa SOF mutants This paper SuperSeries GSE239796 (SubSeries GSE292288) Western blot original data This paper Mendeley Data at https://data.mendeley. com/datasets/fm49hhpdg3/1 (https://doi. org/10.17632/fm49hhpdg3.1) Experimental models: Cell lines HCT 116 ATCC Cat#CCL-247 HT-29 M6 derived from HT-29 ATCC Cat#HTB-38D HEK293T ATCC Cat#CRL-11268 Experimental models: Organisms/strains IκBa knockout (KO) (B6; 129S4Nfkbiatm1Bal/J) mice The Jackson Laboratory Cat#002850 (RRID:IMSR_JAX:002850) Oligonucleotides Primers for inducible mutants, see Table S7 This paper N/A Primers for knockin constructs, see Table S7 This paper N/A Primers for RT-qPCR, see Table S8 This paper N/A Recombinant DNA Plasmid: pMD2.G pMD2.G was a gift from Didier Trono Addgene plasmid Cat#12259; http://n2t. net/addgene:12259; RRID:Addgene_12259 Plasmid: pCMV-dR8.2 dvpr pCMV-dR8.2 dvpr was a gift from Bob Weinberg; Stewart et al., 2003 Addgene plasmid # 8455; http://n2t.net/ addgene:8455; RRID:Addgene_8455 Software and algorithms Prism 10 (v10.3.1.)
Protease Inhibitor:Article Title: Separation-of-function mutants reveal the NF-κB-independent involvement of IκBα in the regulation of intestinal stemness.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alexa Fluor 488 donkey anti-rabbit (2ary) Invitrogen Cat#A21206; RRID: AB_141708 Alexa Fluor 488 donkey anti-mouse (2ary) Invitrogen Cat#A21202; RRID: AB_141607 Alexa Fluor 546 donkey anti-rabbit (2ary) Invitrogen Cat#A10040; RRID: AB_2534016 Alexa Fluor 546 donkey anti-mouse (2ary) Invitrogen Cat#A11036; RRID: AB_10563566 anti-IkBa Santa Cruz Biotechnology Cat#sc-371; RRID: AB_2235952 anti-p50 Santa Cruz Biotechnology Cat#sc-7178; RRID: AB_650211 anti-p65 Santa Cruz Biotechnology Cat#sc-109; RRID: AB_632039 anti-Lamin B Cell Signaling Cat#12586; RRID:AB_2650517 anti-HA Babco Cat#MMS-101R; RRID: AB_291262 anti-SUZ12 Abcam Cat#ab12073; RRID: AB_442939 anti-Tubulin (clone B-5-1-2) Sigma-Aldrich Cat#T6074; RRID: AB_477582 anti-MUC5AC (clone 45M1) Invitrogen Cat#MA5-12178; RRID: AB_10978001 anti-Ki67 (clone MM1) NovoCastra Cat#NCL-Ki67-MM1; RRID: AB_442101 anti-FLAG M2 Sigma-Aldrich Cat#F1804; RRID: AB_262044 Alexa Fluor 647 donkey anti-mouse (2ary) Invitrogen Cat#A31571; RRID: AB_162542 Alexa Fluor 647 donkey anti-rabbit (2ary) Invitrogen Cat#A31573; RRID: AB_2536183 Biological samples Intestinal mouse organoids HMRIB HMRIB Chemicals, peptides, and recombinant proteins DMEM Sigma-Aldrich Cat#D6429 Advanced DMEM/F12 Thermo Fisher Scientific (Gibco) Cat#12634010 B27 supplement (50x) Thermo Fisher Scientific (Gibco) Cat#08–0085 SA N2 supplement (100x) Thermo Fisher Scientific (Gibco) Cat#17502-001 L-Glutamine 100X Thermo Fisher Scientific (Gibco) Cat#25030081 Penicillin/Streptomycin (10.000 U/ml) Thermo Fisher Scientific (Gibco) Cat#15140122 Epidermal Growth Factor, human Sigma-Aldrich Cat#E9644 Recombinant murine Noggin Peprotech Cat#250-38 Mouse R-Spondin 1 Recombinant Protein Peprotech Cat#315-32 Corning® Matrigel® Basement Membrane Matrix Corning Cat#45356234 ROCK inhibitor (Y-27632) Sigma-Aldrich Cat#Y0503 Mouse FGF-basic (FGF-2/bFGF) Recombinant Protein Thermo Fisher Scientific Cat#450-33 Complete Mini protease inhibitor cocktail Roche Cat#11-836-170-001 DPX mountant Sigma-Aldrich Cat#06522 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Protein A-Sepharose CL-4B GE Healthcare Cat17-0780-01 Protein G-Sepharose 4 Fast Flow GE Healthcare Cat#17-0618-01 Alcian blue solution Merck-Milipore Cat#101647 Nuclear Fast Red solution Sigma-Aldrich Cat#6409-77-4 Polyethylenimine Polysciences Inc. Cat#23996 Formaldehyde Sigma-Aldrich Cat#252549 Glycine Sigma-Aldrich Cat#G8790 Dynabeads A Invitrogen Cat#10002D (Continued on next page) 16 Cell Reports 44, 115949, July 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Dynabeads G Invitrogen Cat#10003D Critical commercial assays Envision+ System HRP Labeled Polymer anti-Mouse DAKO Cat#K4001 3,30-diaminobenzidine (DAB) DAKO Cat#K3468 EZ-ECL Chemiluminescence Detection Kit for HRP Biological Industries Cat#20-500-120 ECL Prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 RNeasy Micro Kit Qiagen Cat#74004 Transcriptor First Strand cDNA Synthesis Kit Roche Cat#04896866001 SYBR Green I Master Kit Roche Cat#04887352001 Lenti-X Concentrator Clontech Cat#631232 QIAquick PCR Purification Kit Qiagen Cat #28106 Deposited data RNA-seq inducible IkBa SOF mutants This paper SuperSeries GSE239796 (SubSeries GSE206515) ChIP-seq IkBa-FLAG (HT29 and HCT116 cell lines) This paper SuperSeries GSE239796 (SubSeries GSE271349) RNA-seq KI IkBa SOF mutants This paper SuperSeries GSE239796 (SubSeries GSE292288) Western blot original data This paper Mendeley Data at https://data.mendeley. com/datasets/fm49hhpdg3/1 (https://doi. org/10.17632/fm49hhpdg3.1) Experimental models: Cell lines HCT 116 ATCC Cat#CCL-247 HT-29 M6 derived from HT-29 ATCC Cat#HTB-38D HEK293T ATCC Cat#CRL-11268 Experimental models: Organisms/strains IκBa knockout (KO) (B6; 129S4Nfkbiatm1Bal/J) mice The Jackson Laboratory Cat#002850 (RRID:IMSR_JAX:002850) Oligonucleotides Primers for inducible mutants, see Table S7 This paper N/A Primers for knockin constructs, see Table S7 This paper N/A Primers for RT-qPCR, see Table S8 This paper N/A Recombinant DNA Plasmid: pMD2.G pMD2.G was a gift from Didier Trono Addgene plasmid Cat#12259; http://n2t. net/addgene:12259; RRID:Addgene_12259 Plasmid: pCMV-dR8.2 dvpr pCMV-dR8.2 dvpr was a gift from Bob Weinberg; Stewart et al., 2003 Addgene plasmid # 8455; http://n2t.net/ addgene:8455; RRID:Addgene_8455 Software and algorithms Prism 10 (v10.3.1.)
Article Title: Hypoxia activates SREBP2 through Golgi disassembly in bone marrow-derived monocytes for enhanced tumor growth.
Article Snippet: Fibroblast Basal Medium Lonza Cat# CC-3131 DMEM (High Glucose) Nacalai Tesque Cat# 08459-64 RPMI Medium 1640 Nacalai Tesque Cat# 30264-56 Fetal Bovine Serum Biosera Cat# FB-1285/25 Newborn Calf Lipoprotein-deficient Serum Sigma-Aldrich Cat# S5394 Sulforhodamine B sodium salt Sigma-Aldrich Cat# S1402-5G Ribonuclease Nippon Gene Cat# 313-01461 Propidium Iodide FUJIFILM Wako Cat# 25535-16-4 Mevastatin Sigma-Aldrich Cat# 474700 Mevalonolactone Sigma-Aldrich Cat# M4667 Cholesterol Sigma-Aldrich Cat# C8667 25-hydroxycholesterol Sigma-Aldrich Cat# H1015 Calpain Inhibitor I Nacalai Tesque Cat# 07036-24 DMSO Nacalai Tesque Cat# 09659-14 Methanol FUJIFILM Wako Cat# 134-11821 Ethanol FUJIFILM Wako Cat# 057-00456 14 of 22 The EMBO Journal 42: e114032 | 2023 2023 The Authors D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2001:448a:2022:c5c6:f4a2:de9a:e385:e54e. .. Reagents and Tools table (continued) Reagent/Resource Reference or source Identifier or catalog number Mepanipyrim FUJIFILM Wako Cat# 137-12651 Nocodazole FUJIFILM Wako Cat# 140-08531 Brefeldin A LKT Laboratories Cat# B6816 Phorbol 12-myristate 13-acetate (PMA) AdipoGen Cat# AG-CN2-0010-M010 Pimonidazole Hydrochloride Shinsuke Sando (The University of Tokyo) N/A Atorvastatin calcium salt trihydrate Tokyo Chemical Industry Cat# A2476 Bindarit Cayman Cat# 11479 Isogen reagent Nippon Gene Cat# 311-02504 5X PrimeScript RT Master Mix Takara Cat# RR036A Lipofectamine® RNAiMAX Reagent Thermo Fisher Scientific Cat# 13778-100 Opti-MEM Reduced Serum Medium Thermo Fisher Scientific Cat# 31985-070 DAPI-Fluoromount-G Southern Biotech Cat# 0100-20 cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich Cat# 11836170001 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# 1610374 SuperSignalTM West Dura Extended Duration Substrate Thermo Fisher Scientific Cat# 34075 Ponceau S Nacalai Tesque Cat# 28322-72 Formaldehyde solution Wako Cat# 064-00406 4% paraformaldehyde phosphatebuffered solution FUJIFILM Wako Cat# 163-20145 Software Include version where applicable IMPaLa Kamburov et al (2011) http://impala.molgen.mpg.de/ GeneChip Operating Software Thermo Fisher Scientific https://www.thermofisher.com/jp/en/home/ life-science/microarray-analysis/ LAS X (v. 4.2.1) Leica https://www.leica-microsystems.com/ Seurat 4.0.1 Butler et al (2018) https://satijalab.org/seurat/ Scanpy 1.7.2 Wolf et al (2018) https://scanpy.readthedocs.io/en/stable/ GSVA package 1.38.2 H€anzelmann et al (2013) https://www.bioconductor.org/packages/ release/bioc/html/GSVA.html fgsea package 1.16.0 Korotkevich et al (preprint: Korotkevich et al, 2016) http://bioconductor.org/packages/release/ bioc/html/fgsea.html glmnet package 4.0.2 Hurvich & Tsai (1995) https://cran.r-project.org/web/packages/ glmnet/index.html GEPIA2 Tang et al (2019) http://gepia2.cancer-pku.cn Kaplan-Meier Plotter L anczky et al (2016) http://kmplot.com/analysis/ Other Kits, instrumentation, laboratory equipment, lab ware etc. that are critical for the experimental procedure and do not fit in any of the above categories can be listed here. .. RNeasy microKit Qiagen Cat# 74134 TruSeq RNA Library Prep Illumina Cat# RS-122-2001 or RS-122-2002 Genechip Human Genome U133 plus 2.0 oligonucleotide arrays Thermo Fisher Scientific Cat# 900466 THUNDERBIRD® Probe qPCR Mix TOYOBO Cat# QPS-101 Total Cholesterol Assay Kit (Fluorometric) Cell Biolabs Cat# STA-390 QIA quick PCR purification kit QIAGEN Cat# 28181 2023 The Authors The EMBO Journal 42: e114032 | 2023 15 of 22 D ow nloaded from https://w w w .em bopress.org on January 18, 2024 from IP 2001:448a:2022:c5c6:f4a2:de9a:e385:e54e.
Article Title: LIMK1 Variants Are Associated with Divergent Endocrinological Phenotypes and Altered Exocytosis Dynamics
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Phosphorylated-Cofilin Cell Signaling Cat#: CST 3313T Cofilin Cell Signaling Cat#: CST 5175S LIMK1 Enzo life sciences Cat#: ALX-803-343-C100 GAPDH Novus Biologicals Cat#: NB300-221, RRID: AB_1007762 Mouse Anti-a-Tubulin Millipore Cat#: T5168, RRID: AB_477579 Live/dead fixable viability dye Thermofisher Cat#: 65-0866-18 CD3 Biolegend Cat#: 100216, RRID: AB_493697 CD19 Sony Biotechnology Cat#: 2111140 DRAQ5 Biolegend Cat#: 424101 Phalloidin Sigma Aldrich Cat#: P1951, RRID: AB_2315148 Goat anti rabbit Dako Cat#: P044801-2 Rabbit anti mouse Dako Cat#: P0260, RRID: AB_2636929 Rat anti-HA Roche Cat#: 11867423001, RRID: AB_390918 Phalloidin-iFluor 488 Reagent Abcam Cat#: ab176753 Biological samples Patient derived fibroblasts (individual 1 and 2) and healthy control fibroblasts Wilhelmina Children’s Hospital N/A Patient derived PBMCs and healthy donor PBMCs Wilhelmina Children’s Hospital N/A Patient with LIMK1/ELN hemideletion Center Hospitalier Universitaire (CHU) Dijon N/A Chemicals, peptides, and recombinant proteins FBS Sigma Cat #F7524 DAPI Fluoromount-G Southern Biotech Cat#: 0100-20 Radioimmunoprecipitation assay (RIPA) buffer Sigma Aldrich Cat#: R0278-50mL Polyvinylidene fluoride (PVDF) membranes Millipore Sigma Cat#: IPFL00010 DMEM/F-12 Thermofisher Cat#:11765054 HAM’s F-12 Nutrient Mix Thermofisher Cat#: 11765054 RPMI GenClone Cat#: 25-506 Sodium Pyruvate HyClone Cat#: SH30239.01 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences Cat#: 554714 StemPro Accutase Cell Dissociation Reagent Thermofisher Cat#: A1110501 HEPES GoldBio Cat#: H-400-1 FBS (for INS-1 cells) GenClone Cat#: 52-525 Penicillin-Streptomycin Thermofisher Cat#: 15140122 Trypsin Thermofisher Cat#: 15400054 TrypLE Thermofisher Cat#: 12604021 Phosphatase inhibitor cocktail Merck Cat#: P5726-1ML Ficoll Paque Sigma Cat#: GE17-1440-02 Protease inhibitor cocktail Fisher Scientific Cat#: 10516495 Puromycin GoldBio Cat#: P-600-100 PEI Sigma Cat#: 03880 Gibson Assembly Master Mix New England Biolabs Cat#: E2611L Lipofectamine 2000 ThermoFisher Cat#: 11668027 Glass Coverslips Warner Instruments Cat#: 64-0735 (Continued on next page) iScience 28, 112585, June 20, 2025 e1 ..
Lysis:Article Title: Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH (6C5) (dilution 1:1000) Santa Cruz Cat#sc-32233 Rabbit polyclonal anti-TMEM173/ STING (dilution 1:1000) ProteinTech Cat#19851-1-AP; RRID: AB_10665370 Goat anti-mouse IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2003 Goat anti-rabbit IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2001 (TRITC)-conjugated affinipure goat anti-rabbit IgG (dilution 1:100) ProteinTech Cat#SA00003-2; RRID: AB_2890897 Chemicals, peptides, and recombinant proteins Bovine serum albumin (BSA) Genview Cat#FA016 Paraformaldehyde Sangon Biotech Cat#A500684 RIPA lysis buffer Solarbio Cat#R0020 PBS Solarbio Cat#P1020 Puromycin Sangon Biotech Cat#A610593 Polyethylenimine, linear, MW 25000, transfection grade Polysciences Cat#23966-100 ECL Western Blotting Substrate Millipore Cat#WBKLS0500 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Fetal bovine serum ExCell Bio Cat#FND500 Dulbecco’s modified Eagle’s medium (DMEM) Corning 10-013-CV Roswell Park Memorial Institute (RPMI)-1640 medium Corning 10-040-CV 0.05% (w/v) trypsin HyClone SH30236.02 SDS Sangon Biotech Cat#A600485 KCl Sangon Biotech Cat#A610440 KH2PO4 Sangon Biotech Cat#A600445 NaCl Sangon Biotech Cat#A501218 EDTA Sangon Biotech Cat#B548402 TWEEN 20 Sigma-Aldrich Cat#P2287 Triton X-100 Sigma-Aldrich Cat#T8787 Agarose Biosharp Life Sciences Cat#BS081 Na2HPO4$12H2O Sangon Biotech Cat#A607793 Critical commercial assays ViraTrap Lentivirus Concentration Reagent Biomiga Cat#BW-V2001-03 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Oligonucleotides Sg-STING-A This paper GCGGGCCGACCGCATTTGGG Sg-STING-B This paper ATCCATCCATCCCGTGTCCC Recombinant DNA pBS-CMV-gagpol Addgene Cat#35614 psPAX2 Addgene Cat#12260 pCMV-VSV-G Addgene Cat#8454 lentiCRISPR V2 Addgene Cat#52961 Software and algorithms FiJi (v2.0.0-rc-69/1.52i) ImageJ Schindelin et al.6 https://imagej.net/software/fiji/ Prism 9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Photoshop Adobe https://www.adobe.com/ cn/products/photoshop.html Adobe Illustrator Adobe https://www.adobe.com/ cn/products/illustrator.html (Continued on next page) 2 STAR Protocols 4, 102032, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other 6 well cell culture plate Nest Cat#703001 12 well cell culture plate Nest Cat#712001 15 mL centrifuge tube Nest Cat#601052 50 mL centrifuge tube Nest Cat#602052 Confocal laser scanning microscope Leica TCS SP5 Microscope slide Sail Brand Cat#7107 Circle microscope cover glass Nest Cat#801007 Centrifuge Eppendorf 5810/5810R Tannon-5500 gel imager Tannon Cat#5500 ll OPEN ACCESSProtocol
Transfection:Article Title: Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH (6C5) (dilution 1:1000) Santa Cruz Cat#sc-32233 Rabbit polyclonal anti-TMEM173/ STING (dilution 1:1000) ProteinTech Cat#19851-1-AP; RRID: AB_10665370 Goat anti-mouse IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2003 Goat anti-rabbit IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2001 (TRITC)-conjugated affinipure goat anti-rabbit IgG (dilution 1:100) ProteinTech Cat#SA00003-2; RRID: AB_2890897 Chemicals, peptides, and recombinant proteins Bovine serum albumin (BSA) Genview Cat#FA016 Paraformaldehyde Sangon Biotech Cat#A500684 RIPA lysis buffer Solarbio Cat#R0020 PBS Solarbio Cat#P1020 Puromycin Sangon Biotech Cat#A610593 Polyethylenimine, linear, MW 25000, transfection grade Polysciences Cat#23966-100 ECL Western Blotting Substrate Millipore Cat#WBKLS0500 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Fetal bovine serum ExCell Bio Cat#FND500 Dulbecco’s modified Eagle’s medium (DMEM) Corning 10-013-CV Roswell Park Memorial Institute (RPMI)-1640 medium Corning 10-040-CV 0.05% (w/v) trypsin HyClone SH30236.02 SDS Sangon Biotech Cat#A600485 KCl Sangon Biotech Cat#A610440 KH2PO4 Sangon Biotech Cat#A600445 NaCl Sangon Biotech Cat#A501218 EDTA Sangon Biotech Cat#B548402 TWEEN 20 Sigma-Aldrich Cat#P2287 Triton X-100 Sigma-Aldrich Cat#T8787 Agarose Biosharp Life Sciences Cat#BS081 Na2HPO4$12H2O Sangon Biotech Cat#A607793 Critical commercial assays ViraTrap Lentivirus Concentration Reagent Biomiga Cat#BW-V2001-03 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Oligonucleotides Sg-STING-A This paper GCGGGCCGACCGCATTTGGG Sg-STING-B This paper ATCCATCCATCCCGTGTCCC Recombinant DNA pBS-CMV-gagpol Addgene Cat#35614 psPAX2 Addgene Cat#12260 pCMV-VSV-G Addgene Cat#8454 lentiCRISPR V2 Addgene Cat#52961 Software and algorithms FiJi (v2.0.0-rc-69/1.52i) ImageJ Schindelin et al.6 https://imagej.net/software/fiji/ Prism 9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Photoshop Adobe https://www.adobe.com/ cn/products/photoshop.html Adobe Illustrator Adobe https://www.adobe.com/ cn/products/illustrator.html (Continued on next page) 2 STAR Protocols 4, 102032, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other 6 well cell culture plate Nest Cat#703001 12 well cell culture plate Nest Cat#712001 15 mL centrifuge tube Nest Cat#601052 50 mL centrifuge tube Nest Cat#602052 Confocal laser scanning microscope Leica TCS SP5 Microscope slide Sail Brand Cat#7107 Circle microscope cover glass Nest Cat#801007 Centrifuge Eppendorf 5810/5810R Tannon-5500 gel imager Tannon Cat#5500 ll OPEN ACCESSProtocol
Western Blot:Article Title: Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH (6C5) (dilution 1:1000) Santa Cruz Cat#sc-32233 Rabbit polyclonal anti-TMEM173/ STING (dilution 1:1000) ProteinTech Cat#19851-1-AP; RRID: AB_10665370 Goat anti-mouse IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2003 Goat anti-rabbit IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2001 (TRITC)-conjugated affinipure goat anti-rabbit IgG (dilution 1:100) ProteinTech Cat#SA00003-2; RRID: AB_2890897 Chemicals, peptides, and recombinant proteins Bovine serum albumin (BSA) Genview Cat#FA016 Paraformaldehyde Sangon Biotech Cat#A500684 RIPA lysis buffer Solarbio Cat#R0020 PBS Solarbio Cat#P1020 Puromycin Sangon Biotech Cat#A610593 Polyethylenimine, linear, MW 25000, transfection grade Polysciences Cat#23966-100 ECL Western Blotting Substrate Millipore Cat#WBKLS0500 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Fetal bovine serum ExCell Bio Cat#FND500 Dulbecco’s modified Eagle’s medium (DMEM) Corning 10-013-CV Roswell Park Memorial Institute (RPMI)-1640 medium Corning 10-040-CV 0.05% (w/v) trypsin HyClone SH30236.02 SDS Sangon Biotech Cat#A600485 KCl Sangon Biotech Cat#A610440 KH2PO4 Sangon Biotech Cat#A600445 NaCl Sangon Biotech Cat#A501218 EDTA Sangon Biotech Cat#B548402 TWEEN 20 Sigma-Aldrich Cat#P2287 Triton X-100 Sigma-Aldrich Cat#T8787 Agarose Biosharp Life Sciences Cat#BS081 Na2HPO4$12H2O Sangon Biotech Cat#A607793 Critical commercial assays ViraTrap Lentivirus Concentration Reagent Biomiga Cat#BW-V2001-03 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Oligonucleotides Sg-STING-A This paper GCGGGCCGACCGCATTTGGG Sg-STING-B This paper ATCCATCCATCCCGTGTCCC Recombinant DNA pBS-CMV-gagpol Addgene Cat#35614 psPAX2 Addgene Cat#12260 pCMV-VSV-G Addgene Cat#8454 lentiCRISPR V2 Addgene Cat#52961 Software and algorithms FiJi (v2.0.0-rc-69/1.52i) ImageJ Schindelin et al.6 https://imagej.net/software/fiji/ Prism 9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Photoshop Adobe https://www.adobe.com/ cn/products/photoshop.html Adobe Illustrator Adobe https://www.adobe.com/ cn/products/illustrator.html (Continued on next page) 2 STAR Protocols 4, 102032, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other 6 well cell culture plate Nest Cat#703001 12 well cell culture plate Nest Cat#712001 15 mL centrifuge tube Nest Cat#601052 50 mL centrifuge tube Nest Cat#602052 Confocal laser scanning microscope Leica TCS SP5 Microscope slide Sail Brand Cat#7107 Circle microscope cover glass Nest Cat#801007 Centrifuge Eppendorf 5810/5810R Tannon-5500 gel imager Tannon Cat#5500 ll OPEN ACCESSProtocol
Modification:Article Title: Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH (6C5) (dilution 1:1000) Santa Cruz Cat#sc-32233 Rabbit polyclonal anti-TMEM173/ STING (dilution 1:1000) ProteinTech Cat#19851-1-AP; RRID: AB_10665370 Goat anti-mouse IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2003 Goat anti-rabbit IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2001 (TRITC)-conjugated affinipure goat anti-rabbit IgG (dilution 1:100) ProteinTech Cat#SA00003-2; RRID: AB_2890897 Chemicals, peptides, and recombinant proteins Bovine serum albumin (BSA) Genview Cat#FA016 Paraformaldehyde Sangon Biotech Cat#A500684 RIPA lysis buffer Solarbio Cat#R0020 PBS Solarbio Cat#P1020 Puromycin Sangon Biotech Cat#A610593 Polyethylenimine, linear, MW 25000, transfection grade Polysciences Cat#23966-100 ECL Western Blotting Substrate Millipore Cat#WBKLS0500 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Fetal bovine serum ExCell Bio Cat#FND500 Dulbecco’s modified Eagle’s medium (DMEM) Corning 10-013-CV Roswell Park Memorial Institute (RPMI)-1640 medium Corning 10-040-CV 0.05% (w/v) trypsin HyClone SH30236.02 SDS Sangon Biotech Cat#A600485 KCl Sangon Biotech Cat#A610440 KH2PO4 Sangon Biotech Cat#A600445 NaCl Sangon Biotech Cat#A501218 EDTA Sangon Biotech Cat#B548402 TWEEN 20 Sigma-Aldrich Cat#P2287 Triton X-100 Sigma-Aldrich Cat#T8787 Agarose Biosharp Life Sciences Cat#BS081 Na2HPO4$12H2O Sangon Biotech Cat#A607793 Critical commercial assays ViraTrap Lentivirus Concentration Reagent Biomiga Cat#BW-V2001-03 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Oligonucleotides Sg-STING-A This paper GCGGGCCGACCGCATTTGGG Sg-STING-B This paper ATCCATCCATCCCGTGTCCC Recombinant DNA pBS-CMV-gagpol Addgene Cat#35614 psPAX2 Addgene Cat#12260 pCMV-VSV-G Addgene Cat#8454 lentiCRISPR V2 Addgene Cat#52961 Software and algorithms FiJi (v2.0.0-rc-69/1.52i) ImageJ Schindelin et al.6 https://imagej.net/software/fiji/ Prism 9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Photoshop Adobe https://www.adobe.com/ cn/products/photoshop.html Adobe Illustrator Adobe https://www.adobe.com/ cn/products/illustrator.html (Continued on next page) 2 STAR Protocols 4, 102032, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other 6 well cell culture plate Nest Cat#703001 12 well cell culture plate Nest Cat#712001 15 mL centrifuge tube Nest Cat#601052 50 mL centrifuge tube Nest Cat#602052 Confocal laser scanning microscope Leica TCS SP5 Microscope slide Sail Brand Cat#7107 Circle microscope cover glass Nest Cat#801007 Centrifuge Eppendorf 5810/5810R Tannon-5500 gel imager Tannon Cat#5500 ll OPEN ACCESSProtocol
Concentration Assay:Article Title: Protocol using lentivirus to establish THP-1 suspension cell lines for immunostaining and confocal microscopy.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-GAPDH (6C5) (dilution 1:1000) Santa Cruz Cat#sc-32233 Rabbit polyclonal anti-TMEM173/ STING (dilution 1:1000) ProteinTech Cat#19851-1-AP; RRID: AB_10665370 Goat anti-mouse IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2003 Goat anti-rabbit IgG-HRP (dilution 1:10000) Sungene Biotech Cat#LK2001 (TRITC)-conjugated affinipure goat anti-rabbit IgG (dilution 1:100) ProteinTech Cat#SA00003-2; RRID: AB_2890897 Chemicals, peptides, and recombinant proteins Bovine serum albumin (BSA) Genview Cat#FA016 Paraformaldehyde Sangon Biotech Cat#A500684 RIPA lysis buffer Solarbio Cat#R0020 PBS Solarbio Cat#P1020 Puromycin Sangon Biotech Cat#A610593 Polyethylenimine, linear, MW 25000, transfection grade Polysciences Cat#23966-100 ECL Western Blotting Substrate Millipore Cat#WBKLS0500 DAPI Fluoromount-G Southern Biotech Cat#0100-20 Fetal bovine serum ExCell Bio Cat#FND500 Dulbecco’s modified Eagle’s medium (DMEM) Corning 10-013-CV Roswell Park Memorial Institute (RPMI)-1640 medium Corning 10-040-CV 0.05% (w/v) trypsin HyClone SH30236.02 SDS Sangon Biotech Cat#A600485 KCl Sangon Biotech Cat#A610440 KH2PO4 Sangon Biotech Cat#A600445 NaCl Sangon Biotech Cat#A501218 EDTA Sangon Biotech Cat#B548402 TWEEN 20 Sigma-Aldrich Cat#P2287 Triton X-100 Sigma-Aldrich Cat#T8787 Agarose Biosharp Life Sciences Cat#BS081 Na2HPO4$12H2O Sangon Biotech Cat#A607793 Critical commercial assays ViraTrap Lentivirus Concentration Reagent Biomiga Cat#BW-V2001-03 Experimental models: Cell lines .. HEK293T ATCC CRL-3216 Oligonucleotides Sg-STING-A This paper GCGGGCCGACCGCATTTGGG Sg-STING-B This paper ATCCATCCATCCCGTGTCCC Recombinant DNA pBS-CMV-gagpol Addgene Cat#35614 psPAX2 Addgene Cat#12260 pCMV-VSV-G Addgene Cat#8454 lentiCRISPR V2 Addgene Cat#52961 Software and algorithms FiJi (v2.0.0-rc-69/1.52i) ImageJ Schindelin et al.6 https://imagej.net/software/fiji/ Prism 9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Photoshop Adobe https://www.adobe.com/ cn/products/photoshop.html Adobe Illustrator Adobe https://www.adobe.com/ cn/products/illustrator.html (Continued on next page) 2 STAR Protocols 4, 102032, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other 6 well cell culture plate Nest Cat#703001 12 well cell culture plate Nest Cat#712001 15 mL centrifuge tube Nest Cat#601052 50 mL centrifuge tube Nest Cat#602052 Confocal laser scanning microscope Leica TCS SP5 Microscope slide Sail Brand Cat#7107 Circle microscope cover glass Nest Cat#801007 Centrifuge Eppendorf 5810/5810R Tannon-5500 gel imager Tannon Cat#5500 ll OPEN ACCESSProtocol
Derivative Assay:Article Title: LIMK1 Variants Are Associated with Divergent Endocrinological Phenotypes and Altered Exocytosis Dynamics
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Phosphorylated-Cofilin Cell Signaling Cat#: CST 3313T Cofilin Cell Signaling Cat#: CST 5175S LIMK1 Enzo life sciences Cat#: ALX-803-343-C100 GAPDH Novus Biologicals Cat#: NB300-221, RRID: AB_1007762 Mouse Anti-a-Tubulin Millipore Cat#: T5168, RRID: AB_477579 Live/dead fixable viability dye Thermofisher Cat#: 65-0866-18 CD3 Biolegend Cat#: 100216, RRID: AB_493697 CD19 Sony Biotechnology Cat#: 2111140 DRAQ5 Biolegend Cat#: 424101 Phalloidin Sigma Aldrich Cat#: P1951, RRID: AB_2315148 Goat anti rabbit Dako Cat#: P044801-2 Rabbit anti mouse Dako Cat#: P0260, RRID: AB_2636929 Rat anti-HA Roche Cat#: 11867423001, RRID: AB_390918 Phalloidin-iFluor 488 Reagent Abcam Cat#: ab176753 Biological samples Patient derived fibroblasts (individual 1 and 2) and healthy control fibroblasts Wilhelmina Children’s Hospital N/A Patient derived PBMCs and healthy donor PBMCs Wilhelmina Children’s Hospital N/A Patient with LIMK1/ELN hemideletion Center Hospitalier Universitaire (CHU) Dijon N/A Chemicals, peptides, and recombinant proteins FBS Sigma Cat #F7524 DAPI Fluoromount-G Southern Biotech Cat#: 0100-20 Radioimmunoprecipitation assay (RIPA) buffer Sigma Aldrich Cat#: R0278-50mL Polyvinylidene fluoride (PVDF) membranes Millipore Sigma Cat#: IPFL00010 DMEM/F-12 Thermofisher Cat#:11765054 HAM’s F-12 Nutrient Mix Thermofisher Cat#: 11765054 RPMI GenClone Cat#: 25-506 Sodium Pyruvate HyClone Cat#: SH30239.01 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences Cat#: 554714 StemPro Accutase Cell Dissociation Reagent Thermofisher Cat#: A1110501 HEPES GoldBio Cat#: H-400-1 FBS (for INS-1 cells) GenClone Cat#: 52-525 Penicillin-Streptomycin Thermofisher Cat#: 15140122 Trypsin Thermofisher Cat#: 15400054 TrypLE Thermofisher Cat#: 12604021 Phosphatase inhibitor cocktail Merck Cat#: P5726-1ML Ficoll Paque Sigma Cat#: GE17-1440-02 Protease inhibitor cocktail Fisher Scientific Cat#: 10516495 Puromycin GoldBio Cat#: P-600-100 PEI Sigma Cat#: 03880 Gibson Assembly Master Mix New England Biolabs Cat#: E2611L Lipofectamine 2000 ThermoFisher Cat#: 11668027 Glass Coverslips Warner Instruments Cat#: 64-0735 (Continued on next page) iScience 28, 112585, June 20, 2025 e1 ..
Control:Article Title: LIMK1 Variants Are Associated with Divergent Endocrinological Phenotypes and Altered Exocytosis Dynamics
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Phosphorylated-Cofilin Cell Signaling Cat#: CST 3313T Cofilin Cell Signaling Cat#: CST 5175S LIMK1 Enzo life sciences Cat#: ALX-803-343-C100 GAPDH Novus Biologicals Cat#: NB300-221, RRID: AB_1007762 Mouse Anti-a-Tubulin Millipore Cat#: T5168, RRID: AB_477579 Live/dead fixable viability dye Thermofisher Cat#: 65-0866-18 CD3 Biolegend Cat#: 100216, RRID: AB_493697 CD19 Sony Biotechnology Cat#: 2111140 DRAQ5 Biolegend Cat#: 424101 Phalloidin Sigma Aldrich Cat#: P1951, RRID: AB_2315148 Goat anti rabbit Dako Cat#: P044801-2 Rabbit anti mouse Dako Cat#: P0260, RRID: AB_2636929 Rat anti-HA Roche Cat#: 11867423001, RRID: AB_390918 Phalloidin-iFluor 488 Reagent Abcam Cat#: ab176753 Biological samples Patient derived fibroblasts (individual 1 and 2) and healthy control fibroblasts Wilhelmina Children’s Hospital N/A Patient derived PBMCs and healthy donor PBMCs Wilhelmina Children’s Hospital N/A Patient with LIMK1/ELN hemideletion Center Hospitalier Universitaire (CHU) Dijon N/A Chemicals, peptides, and recombinant proteins FBS Sigma Cat #F7524 DAPI Fluoromount-G Southern Biotech Cat#: 0100-20 Radioimmunoprecipitation assay (RIPA) buffer Sigma Aldrich Cat#: R0278-50mL Polyvinylidene fluoride (PVDF) membranes Millipore Sigma Cat#: IPFL00010 DMEM/F-12 Thermofisher Cat#:11765054 HAM’s F-12 Nutrient Mix Thermofisher Cat#: 11765054 RPMI GenClone Cat#: 25-506 Sodium Pyruvate HyClone Cat#: SH30239.01 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences Cat#: 554714 StemPro Accutase Cell Dissociation Reagent Thermofisher Cat#: A1110501 HEPES GoldBio Cat#: H-400-1 FBS (for INS-1 cells) GenClone Cat#: 52-525 Penicillin-Streptomycin Thermofisher Cat#: 15140122 Trypsin Thermofisher Cat#: 15400054 TrypLE Thermofisher Cat#: 12604021 Phosphatase inhibitor cocktail Merck Cat#: P5726-1ML Ficoll Paque Sigma Cat#: GE17-1440-02 Protease inhibitor cocktail Fisher Scientific Cat#: 10516495 Puromycin GoldBio Cat#: P-600-100 PEI Sigma Cat#: 03880 Gibson Assembly Master Mix New England Biolabs Cat#: E2611L Lipofectamine 2000 ThermoFisher Cat#: 11668027 Glass Coverslips Warner Instruments Cat#: 64-0735 (Continued on next page) iScience 28, 112585, June 20, 2025 e1 ..
Radio Immunoprecipitation:Article Title: LIMK1 Variants Are Associated with Divergent Endocrinological Phenotypes and Altered Exocytosis Dynamics
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Phosphorylated-Cofilin Cell Signaling Cat#: CST 3313T Cofilin Cell Signaling Cat#: CST 5175S LIMK1 Enzo life sciences Cat#: ALX-803-343-C100 GAPDH Novus Biologicals Cat#: NB300-221, RRID: AB_1007762 Mouse Anti-a-Tubulin Millipore Cat#: T5168, RRID: AB_477579 Live/dead fixable viability dye Thermofisher Cat#: 65-0866-18 CD3 Biolegend Cat#: 100216, RRID: AB_493697 CD19 Sony Biotechnology Cat#: 2111140 DRAQ5 Biolegend Cat#: 424101 Phalloidin Sigma Aldrich Cat#: P1951, RRID: AB_2315148 Goat anti rabbit Dako Cat#: P044801-2 Rabbit anti mouse Dako Cat#: P0260, RRID: AB_2636929 Rat anti-HA Roche Cat#: 11867423001, RRID: AB_390918 Phalloidin-iFluor 488 Reagent Abcam Cat#: ab176753 Biological samples Patient derived fibroblasts (individual 1 and 2) and healthy control fibroblasts Wilhelmina Children’s Hospital N/A Patient derived PBMCs and healthy donor PBMCs Wilhelmina Children’s Hospital N/A Patient with LIMK1/ELN hemideletion Center Hospitalier Universitaire (CHU) Dijon N/A Chemicals, peptides, and recombinant proteins FBS Sigma Cat #F7524 DAPI Fluoromount-G Southern Biotech Cat#: 0100-20 Radioimmunoprecipitation assay (RIPA) buffer Sigma Aldrich Cat#: R0278-50mL Polyvinylidene fluoride (PVDF) membranes Millipore Sigma Cat#: IPFL00010 DMEM/F-12 Thermofisher Cat#:11765054 HAM’s F-12 Nutrient Mix Thermofisher Cat#: 11765054 RPMI GenClone Cat#: 25-506 Sodium Pyruvate HyClone Cat#: SH30239.01 BD Cytofix/Cytoperm Fixation/Permeabilization Kit BD Biosciences Cat#: 554714 StemPro Accutase Cell Dissociation Reagent Thermofisher Cat#: A1110501 HEPES GoldBio Cat#: H-400-1 FBS (for INS-1 cells) GenClone Cat#: 52-525 Penicillin-Streptomycin Thermofisher Cat#: 15140122 Trypsin Thermofisher Cat#: 15400054 TrypLE Thermofisher Cat#: 12604021 Phosphatase inhibitor cocktail Merck Cat#: P5726-1ML Ficoll Paque Sigma Cat#: GE17-1440-02 Protease inhibitor cocktail Fisher Scientific Cat#: 10516495 Puromycin GoldBio Cat#: P-600-100 PEI Sigma Cat#: 03880 Gibson Assembly Master Mix New England Biolabs Cat#: E2611L Lipofectamine 2000 ThermoFisher Cat#: 11668027 Glass Coverslips Warner Instruments Cat#: 64-0735 (Continued on next page) iScience 28, 112585, June 20, 2025 e1 ..
|
SouthernBiotech is a verified supplier 